ID: 1010661845_1010661846

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1010661845 1010661846
Species Human (GRCh38) Human (GRCh38)
Location 6:78580665-78580687 6:78580699-78580721
Sequence CCAGTTTGAGCAATTACATCAGT CAGCTGTTCTAAAAAACATAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 115} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!