ID: 1010665898_1010665906

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1010665898 1010665906
Species Human (GRCh38) Human (GRCh38)
Location 6:78629568-78629590 6:78629615-78629637
Sequence CCGCATAAAAAAGCGCAGTCTGG ACCGAAGGCACCAACAGCTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 100} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!