ID: 1010693027_1010693031

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1010693027 1010693031
Species Human (GRCh38) Human (GRCh38)
Location 6:78933114-78933136 6:78933157-78933179
Sequence CCAATGAGAGCCTGTCCTTTGAA TAGCTATGAAAGTCCTAGATTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 188} {0: 6, 1: 9, 2: 13, 3: 20, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!