ID: 1010700147_1010700150

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1010700147 1010700150
Species Human (GRCh38) Human (GRCh38)
Location 6:79034843-79034865 6:79034892-79034914
Sequence CCCAAAGAGTTAAAGAAATCAAC CTAATATTCTTTGAGTGTGCGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 20, 3: 74, 4: 412} {0: 1, 1: 0, 2: 1, 3: 8, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!