ID: 1010703129_1010703141

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1010703129 1010703141
Species Human (GRCh38) Human (GRCh38)
Location 6:79077106-79077128 6:79077151-79077173
Sequence CCGCCGCCGCCGACTCTCGCGCG CGCGCCGGCCCCTCCTCCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 289} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!