ID: 1010732787_1010732792

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1010732787 1010732792
Species Human (GRCh38) Human (GRCh38)
Location 6:79408937-79408959 6:79408981-79409003
Sequence CCACTGGGCAGTTGTGACAGAAT CCTTTCAAGTATTCACATTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 160} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!