|
Left Crispr |
Right Crispr |
| Crispr ID |
1010775967 |
1010775972 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:79886199-79886221
|
6:79886216-79886238
|
| Sequence |
CCCACAATCACAGGCAACCAAAG |
CCAAAGCAAATATGGGCAAATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 6, 1: 405, 2: 716, 3: 884, 4: 1064} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|