|
Left Crispr |
Right Crispr |
| Crispr ID |
1010775968 |
1010775973 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:79886200-79886222
|
6:79886217-79886239
|
| Sequence |
CCACAATCACAGGCAACCAAAGC |
CAAAGCAAATATGGGCAAATGGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 2, 1: 42, 2: 610, 3: 1158, 4: 4051} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|