ID: 1010780298_1010780304

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1010780298 1010780304
Species Human (GRCh38) Human (GRCh38)
Location 6:79938017-79938039 6:79938069-79938091
Sequence CCATGCCCAAGTGCAGGTGATGT TTCATAAAAGCCAGTTCATAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 27, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!