ID: 1010792329_1010792331

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1010792329 1010792331
Species Human (GRCh38) Human (GRCh38)
Location 6:80078697-80078719 6:80078713-80078735
Sequence CCTCACAATAATGTAAGCAACAA GCAACAAGGCAAAATTAAATAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!