ID: 1010837824_1010837828

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1010837824 1010837828
Species Human (GRCh38) Human (GRCh38)
Location 6:80612061-80612083 6:80612107-80612129
Sequence CCTGAGAGTGGTTCAAAATTGAG GAAGCTTTCAGAGCCTGTTGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!