ID: 1010865954_1010865959

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1010865954 1010865959
Species Human (GRCh38) Human (GRCh38)
Location 6:80976978-80977000 6:80977004-80977026
Sequence CCTCAATTTGCATTGACCTGCCC ACTATGGATGTACTTGAAAGTGG
Strand - +
Off-target summary {0: 4, 1: 11, 2: 20, 3: 46, 4: 150} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!