|
Left Crispr |
Right Crispr |
Crispr ID |
1010906984 |
1010906986 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
6:81502761-81502783
|
6:81502808-81502830
|
Sequence |
CCTATAGAATGGCAGAAAATATT |
TCTAATATTTAGTATCTGTAAGG |
Strand |
- |
+ |
Off-target summary |
{0: 7, 1: 395, 2: 4435, 3: 16336, 4: 18289} |
{0: 1, 1: 4, 2: 64, 3: 587, 4: 2513} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|