ID: 1010958359_1010958361

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1010958359 1010958361
Species Human (GRCh38) Human (GRCh38)
Location 6:82117331-82117353 6:82117346-82117368
Sequence CCTGAGACAGAGAGACTATGTAG CTATGTAGGCAGCTATTGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 186} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!