ID: 1010968302_1010968307

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1010968302 1010968307
Species Human (GRCh38) Human (GRCh38)
Location 6:82237237-82237259 6:82237264-82237286
Sequence CCAGCAGAAACTGAAAAAAAAAA AAGGTTTTACAGATGGAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 38, 3: 359, 4: 3245} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!