ID: 1011045336_1011045342

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1011045336 1011045342
Species Human (GRCh38) Human (GRCh38)
Location 6:83075702-83075724 6:83075752-83075774
Sequence CCAACAGTGTTTGACAAGGGTGC CCTCTTCACCAGATAGTGTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 44, 4: 533}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!