ID: 1011050307_1011050311

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1011050307 1011050311
Species Human (GRCh38) Human (GRCh38)
Location 6:83140632-83140654 6:83140656-83140678
Sequence CCCCAGTCCAATTTTTGAATATG TCTTTACCACAGATTCCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 336} {0: 1, 1: 0, 2: 2, 3: 19, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!