ID: 1011061952_1011061954

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1011061952 1011061954
Species Human (GRCh38) Human (GRCh38)
Location 6:83279997-83280019 6:83280019-83280041
Sequence CCAACCTACAATTCTGCATCATG GTAATACACTGATATACTGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 222} {0: 1, 1: 0, 2: 0, 3: 19, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!