ID: 1011067293_1011067297

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1011067293 1011067297
Species Human (GRCh38) Human (GRCh38)
Location 6:83341056-83341078 6:83341105-83341127
Sequence CCATGTGATCTGGGGTAGGGCAT GGAGACTGAGTTCAACCACCTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 4, 3: 54, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!