ID: 1011095772_1011095776

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1011095772 1011095776
Species Human (GRCh38) Human (GRCh38)
Location 6:83660238-83660260 6:83660279-83660301
Sequence CCATGTAAGAAGTTAGAGGAAGG CTCTCGTGAGAAGAGGGTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 207} {0: 1, 1: 0, 2: 1, 3: 16, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!