ID: 1011195321_1011195333

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1011195321 1011195333
Species Human (GRCh38) Human (GRCh38)
Location 6:84774329-84774351 6:84774364-84774386
Sequence CCGAGCCTCCGCGGCGCCCGCGC GTCCCGGCTCTCTCCAGGCCCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!