ID: 1011273833_1011273834

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1011273833 1011273834
Species Human (GRCh38) Human (GRCh38)
Location 6:85607986-85608008 6:85607999-85608021
Sequence CCTAGGGGTATAAGCTAAAACCC GCTAAAACCCACAAATATATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55} {0: 1, 1: 0, 2: 0, 3: 27, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!