ID: 1011359821_1011359822

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1011359821 1011359822
Species Human (GRCh38) Human (GRCh38)
Location 6:86511395-86511417 6:86511411-86511433
Sequence CCAAAGCACACAGATTATTTCTC ATTTCTCCACTCCACAGCATAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!