ID: 1011418901_1011418914

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1011418901 1011418914
Species Human (GRCh38) Human (GRCh38)
Location 6:87151996-87152018 6:87152046-87152068
Sequence CCGCGGCGGCAAACGCCGGGCCT TTCGCGGGCGGCGGCGGCGGCGG
Strand - +
Off-target summary No data {0: 2, 1: 3, 2: 53, 3: 352, 4: 2786}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!