ID: 1011428546_1011428550

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1011428546 1011428550
Species Human (GRCh38) Human (GRCh38)
Location 6:87258068-87258090 6:87258120-87258142
Sequence CCAGTGTCAGTCAAGAAGGTAGT TGGCATTCCCAGTACATTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 109} {0: 1, 1: 0, 2: 0, 3: 10, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!