ID: 1011428961_1011428966

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1011428961 1011428966
Species Human (GRCh38) Human (GRCh38)
Location 6:87264672-87264694 6:87264707-87264729
Sequence CCACTTGGAAAGATAGGAAGTTG CTGAAGAAGCAGATGGGTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 200} {0: 1, 1: 0, 2: 6, 3: 39, 4: 381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!