ID: 1011453713_1011453716

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1011453713 1011453716
Species Human (GRCh38) Human (GRCh38)
Location 6:87524264-87524286 6:87524278-87524300
Sequence CCCTCAGCCTGCTTTACCAAATC TACCAAATCCCAATGAGTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 150} {0: 1, 1: 0, 2: 0, 3: 10, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!