ID: 1011476775_1011476780

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1011476775 1011476780
Species Human (GRCh38) Human (GRCh38)
Location 6:87756161-87756183 6:87756176-87756198
Sequence CCCCACCTAAAGGCTTTAGCACC TTAGCACCAAATTGCTGAGAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!