ID: 1011482795_1011482800

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1011482795 1011482800
Species Human (GRCh38) Human (GRCh38)
Location 6:87811926-87811948 6:87811953-87811975
Sequence CCCTGAGTTGTTTTTCAGAAACC TCCCCACCCAATGGATCCACTGG
Strand - +
Off-target summary {0: 53, 1: 69, 2: 95, 3: 68, 4: 309} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!