ID: 1011489766_1011489770

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1011489766 1011489770
Species Human (GRCh38) Human (GRCh38)
Location 6:87878988-87879010 6:87879027-87879049
Sequence CCATCACTATCAAAATTTTGTCC TGAGATCGGCTGCAATAAGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!