ID: 1011490582_1011490586

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1011490582 1011490586
Species Human (GRCh38) Human (GRCh38)
Location 6:87887149-87887171 6:87887200-87887222
Sequence CCTTCTGAGGTTACCAAGCGGTT AAAGAAAAAGAACATGTTCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 23, 3: 204, 4: 1697}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!