ID: 1011517061_1011517067

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1011517061 1011517067
Species Human (GRCh38) Human (GRCh38)
Location 6:88166303-88166325 6:88166327-88166349
Sequence CCCGCTCGCGCAGTCCCTGCCGC CCCTCCGCTCGCGCTGTCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 184} {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!