ID: 1011577977_1011577980

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1011577977 1011577980
Species Human (GRCh38) Human (GRCh38)
Location 6:88825851-88825873 6:88825874-88825896
Sequence CCACTATCCTTCTCCTCACTCTG CACCCGTGTCCAACAAAGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 85, 4: 610} {0: 1, 1: 0, 2: 0, 3: 4, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!