|
Left Crispr |
Right Crispr |
| Crispr ID |
1011578092 |
1011578098 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:88827137-88827159
|
6:88827189-88827211
|
| Sequence |
CCAGCGAGATCAATGCAGAAGGC |
CTGGCTCATCTCGTTGGGATTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 32, 1: 198, 2: 452, 3: 696, 4: 1249} |
{0: 1, 1: 5, 2: 95, 3: 626, 4: 993} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|