ID: 1011590019_1011590028

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1011590019 1011590028
Species Human (GRCh38) Human (GRCh38)
Location 6:88963181-88963203 6:88963232-88963254
Sequence CCCGTTCATGTTCCCATTCATCC CGCTCCTGAAATACCACTAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 283} {0: 1, 1: 0, 2: 0, 3: 2, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!