ID: 1011603721_1011603729

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1011603721 1011603729
Species Human (GRCh38) Human (GRCh38)
Location 6:89081776-89081798 6:89081820-89081842
Sequence CCGCGGGAGGGCTGACGTCAGCG CGGCGCCCATGAAGGAGGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 61} {0: 1, 1: 0, 2: 0, 3: 10, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!