ID: 1011640446_1011640459

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1011640446 1011640459
Species Human (GRCh38) Human (GRCh38)
Location 6:89412200-89412222 6:89412236-89412258
Sequence CCGCCCCGCCCGCCGGCGGAGGA CGGCAGTTCCTCCCGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 235} {0: 1, 1: 1, 2: 0, 3: 3, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!