ID: 1011643730_1011643736

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1011643730 1011643736
Species Human (GRCh38) Human (GRCh38)
Location 6:89437992-89438014 6:89438015-89438037
Sequence CCTTGTTGCCCAGGCTCACACTG GTTTTAAACTCAGATGAATGGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 28, 3: 276, 4: 2323} {0: 1, 1: 0, 2: 1, 3: 19, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!