ID: 1011649181_1011649186

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1011649181 1011649186
Species Human (GRCh38) Human (GRCh38)
Location 6:89490259-89490281 6:89490283-89490305
Sequence CCCATTACTGGGTCTTCAAATCA TTTTATGGGTGCAACTGACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 196} {0: 1, 1: 0, 2: 0, 3: 15, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!