|
Left Crispr |
Right Crispr |
| Crispr ID |
1011652176 |
1011652179 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:89516630-89516652
|
6:89516645-89516667
|
| Sequence |
CCACTCCCAGCTAATATTTGTAT |
ATTTGTATTTTTAGTAGAGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 1086, 2: 37414, 3: 77522, 4: 109774} |
{0: 1194, 1: 199808, 2: 143919, 3: 66988, 4: 40675} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|