|
Left Crispr |
Right Crispr |
| Crispr ID |
1011670983 |
1011670987 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:89682803-89682825
|
6:89682823-89682845
|
| Sequence |
CCAGGCATGGTGGCATGTGCCTG |
CTGTGGTCCCAGCACTCAGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2027, 1: 10248, 2: 34963, 3: 80042, 4: 140234} |
{0: 3, 1: 38, 2: 160, 3: 937, 4: 6697} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|