|
Left Crispr |
Right Crispr |
| Crispr ID |
1011690428 |
1011690435 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:89861976-89861998
|
6:89862017-89862039
|
| Sequence |
CCTGCCTCGGCCTCTCAAAGTGC |
CTACCATGCCTGGCCAAAGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2380, 1: 93440, 2: 229088, 3: 235883, 4: 155983} |
{0: 1, 1: 2, 2: 26, 3: 144, 4: 762} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|