|
Left Crispr |
Right Crispr |
Crispr ID |
1011690430 |
1011690435 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
6:89861980-89862002
|
6:89862017-89862039
|
Sequence |
CCTCGGCCTCTCAAAGTGCTGGG |
CTACCATGCCTGGCCAAAGCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 3465, 1: 125828, 2: 269574, 3: 211978, 4: 127563} |
{0: 1, 1: 2, 2: 26, 3: 144, 4: 762} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|