ID: 1011704817_1011704820

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1011704817 1011704820
Species Human (GRCh38) Human (GRCh38)
Location 6:89990205-89990227 6:89990230-89990252
Sequence CCTTAGAGACAGGAGTCGGTGCA CTGGGAGTTAACATTTTCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 90} {0: 1, 1: 0, 2: 4, 3: 22, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!