ID: 1011734209_1011734213

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1011734209 1011734213
Species Human (GRCh38) Human (GRCh38)
Location 6:90296231-90296253 6:90296249-90296271
Sequence CCGGGAGGGAGAGCACACATTCG ATTCGGCGCGGCGCGGCCGCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!