ID: 1011779075_1011779077

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1011779075 1011779077
Species Human (GRCh38) Human (GRCh38)
Location 6:90766449-90766471 6:90766463-90766485
Sequence CCATTCACCTTGGAATTGCAGAG ATTGCAGAGAAACCAAACTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 31, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!