ID: 1011816950_1011816954

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1011816950 1011816954
Species Human (GRCh38) Human (GRCh38)
Location 6:91203098-91203120 6:91203129-91203151
Sequence CCCTTCACAAATGGTAGCCACCA TCTACGAATGTGACCACTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 122} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!