ID: 1011858631_1011858638

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1011858631 1011858638
Species Human (GRCh38) Human (GRCh38)
Location 6:91726841-91726863 6:91726878-91726900
Sequence CCCCCACAATTCTAGGCCTACCT CATCCTATTTCCCCCCTTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 11, 4: 104} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!