ID: 1011934190_1011934198

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1011934190 1011934198
Species Human (GRCh38) Human (GRCh38)
Location 6:92754376-92754398 6:92754412-92754434
Sequence CCACCTCTAATTGGCCCCATGGA GCTGATCACAGCTCAGCTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102} {0: 1, 1: 0, 2: 7, 3: 21, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!