ID: 1011982704_1011982707

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1011982704 1011982707
Species Human (GRCh38) Human (GRCh38)
Location 6:93403045-93403067 6:93403093-93403115
Sequence CCAGAAGACAGTCTTGTTTATGT GTTATTTGCTATGAGGAAAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 32, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!